RNA-seq Graph Builder
RNA-seq Graph Builder is a method to reconstruct the Isoform Graph of a gene from RNA-seq data, without the genome information, where such a graph is a representation of the variants of alternative splicing of the gene structure.
Last release: March 27, 2012
Introduction
This program predicts from NGS data the gene structure induced by the different full-length isoforms due to alternative splicing. More precisely, it analyzes RNA-seq data that have been sampled from the transcripts of a gene, with the goal of building a graph representation of the variants of alternative splicing corresponding to those full-length isoforms. The novelty of this method relies on the fact that it builds such a graph in absence of the genome. A subsequent step is to efficiently map the graph to the genome in order to refine the gene structure and to compute intron data that, obviously, cannot be present in the isoforms.
Download and Installation
RNA-seq-Graph-Builder is currently distributed only on source form. It has been developed on Ubuntu Linux machines (v. 10.04 and 10.10) and has been tested on both 32 and 64 bit. The program requires the C++ library SEQAN available at http://www.seqan.de or it is possible to install the develop package seqan-dev by typing:
$ sudo apt-get install seqan-dev
Download
RNA-seq-Graph-Builder is developed on the AlgoLab/RNA-seq-Graph
Git repository hosted by GitHub. The repository can be explored using the GitHub web interface at https://github.com/AlgoLab/RNA-seq-Graph.
It is also possible to clone the entire repository using the following command:
$ git clone git://github.com/AlgoLab/RNA-seq-Graph.git
The source code is available directly in zip or tar.gz
Or, if you have a GitHub account, you can fork the project from the repository web page.
Compilation
The program can be compiled by issuing the command at the command prompt:
$ make
There is also the possibility to compile with the low_mem
option in order to reduce the memory consumption. In this way the memory occupation (i.e. the heap peak) is reduced by ~35% but the time required is increased by ~10%. Starting from a cleaned repository, the command is:
$ make low_mem
Usage
The program takes as input a FASTA file with the RNA-seq data of a gene and returns the RNA-seq Graph. (The file formats are described below.) The program is executed by typing the following command:
$ ./bin/build_RNA_seq_graph [options] --reads <RNA-seq_file>
where the possible options are:
--ref_level {1-5}
1
- Standard Algorithm (Default option)
2
- Add tiny blocks
3
- Add linking edges
4
- Add small blocks
5
- Refine overlapping nodes
-o <graphML_out_file> (Default: std output)
--advanced (For debug)
--help (Print this screen)
Alternatively it is possible to view the debug options by typing:
$ ./bin/build_RNA_seq_graph --advanced
that prints the following options:
--ref_level {1-5}
1
- Standard Algorithm (Default option)
2
- Add tiny blocks
3
- Add linking edges
4
- Add small blocks
5
- Refine overlapping nodes
-o <graphML_out_file> (Default: std output)
--debug {1...8}
1
- Print left hash table
2
- Print right hash table
3
- Print unspliced RNA-seq sequences
4
- Print spliced RNA-seq sequences
5
- Print half spliced RNA-seq sequences
6
- Build chains of unspliced reads with half sequence overlap
7
- Build chains of unspliced reads with specific overlap
8
- Merge chains built of unspliced reads with half sequence overlap
An example of usage is:
$ ./bin/build_RNA_seq_graph --reads Raw_file.fa -o Out_file
A summary of the available program options can be printed by invoking ./bin/build_RNA_seq_graph
without parameters.
File Formats
Input: RNA-seq Dataset
RNA-seq file is in FASTA format (.fa, .fas or .fasta). In particular, each line of the input file describes a single read and it is composed by at least 2 rows: the first one is the header of the read (that usually starts with ’>’) and the second one that contains the sequence. For example:
>B2GA004:3:100:1143:752#0/1 /source=region /gene_id=gene /gene_strand=+
GATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTACATTGCTGAGGACGAGAATGGGAAGAT
Output: RNA-seq Graph
The program produces as output a file in txt format that contains a list of nodes and arcs of the RNA-seq graph. It also gives as output the same graph in GDL format (http://www.absint.com/aisee/manual/windows/node58.html). It also print on standard output the graph in GraphML format; this latter can be redirected into a file in order to visualize or export it. By default the files are RNA-seq-graph.txt and RNA-seq-graph.gdl . For example:
$ ./bin/build_RNA_seq_graph --reads Raw_file.fa > RNA-seq-graph.graphml
If the option -o
is specified the 3 files will have the specified name:
$ ./bin/build_RNA_seq_graph --reads Raw_file.fa -o Out-file
generates Out-file.txt, Out-file.gdl and Out-file.graphml.
License
RNA-seq-Graph-Builder is released under the terms of the GNU General Public License (GPL) as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
RNA-seq-Graph-Builder is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.
Please refer to file COPYING
or to the GNU website for a copy of the GNU General Public License.
Contacts
Please contact Stefano Beretta for additional information.
E-mail: beretta@disco.unimib.it
Web page: http://www.algolab.eu/people/beretta-stefano/